Genomic DNA Control, Human, Methylated BioGenomics™
Methylated human jurkat cell genomic DNA was generated by treating genomic DNA with methylase which specifically methylates the CpG into CmpG within double stranded dinucleotide recongnition sequence. The fully methylated genomic DNA is provided undigested and can be used as methylated control DNA for research.
The primer set is designed to amplify a human gene fragment following bisulfite treatment. The methylated CG remains unconverted following bisulfite treatment, whereas non-methylated cytosines are converted into uracil and detected as thymine after PCR. The 220bp PCR product can be detected on a 3% DNA gel.
Quality Control
1. The methylated genomic DNA is tested with the control primers, a 220bp size band can visualized on 3% agarose gel. 2. The CmpG sequences are confirmed by sequencing analysis after bisulfite conversion. 3. The methylated genomic DNA purity is tested by spectrophotometer, A260/280 is between 1.7 and 2.0, A260/230 is >2.0. (detected in 10mM Tris-Cl, pH 7.5)
Control Primer (Included)
169770A: Control Primer, 1x10ul
For a 25ul total reaction volume
1. Add 5ul 169770 Converted methylated control DNA 2. Add 1ul primer mixture: Standard PCR buffer with 10mM dNTP mix MgCl2 2.5mM, if needed DNA Polymerase
B. PCR Condition
1. 95°C, 5 minutes 2. 95°C, 40 seconds 3. 60°C, 40 seconds 4. 72°C, 40 seconds 5. Repeat steps 2 through 4 for 45 times. 6. 72°C, 4 minutes 7. 4°C
The PCR production is also can be conformed by sequencing: Only CG sequences are stay in CG without converted and no CC, CT or CA sequences can be detected. That means the C is converted to T except the methylated CG.
TTTTCGCGTTAGAGACGTAGTCGCGTTTTTATTATTTATATTTATCGCGTTTTCGTTCGTTTTTTTTTCG GGAGTTAGTTCGCGTTATCGTCGTTGTTTAGGTTATCGTTATTTTTCGTAGTTATGTTTATTAGGTTCG TGTTTTCGTTTTTTTATCGTAGGATGTTCGGCGGTTCGGGTATCGCGAGTCGGTCGAGTTTT
Storage and Stability
Store at -20°C. Stable for 6 months after receipt at -20°C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
Important Note
This product as supplied is intended for research use only, not for use in human, therapeutic or diagnostic applications without the expressed written authorization of United States Biological.