The primer set is designed to amplify a human gene fragment following bisulfite treatment. The methylated CG remains unconverted following bisulfite treatment, whereas non-methylated cytosines are converted into uracil and detected as thymine after PCR. The 220bp PCR product can be detected on a 3% DNA gel.

1. The methylated genomic DNA is tested with the control primers, a 220bp size band can visualized on 3% agarose gel. 2. The CmpG sequences are confirmed by sequencing analysis after bisulfite conversion. 3. The methylated genomic DNA purity is tested by spectrophotometer, A260/280 is between 1.7 and 2.0, A260/230 is >2.0. (detected in 10mM Tris-Cl, pH 7.5)

169770A: Control Primer, 1x10ul

1. Add 5ul 169770 Converted methylated control DNA 2. Add 1ul primer mixture: Standard PCR buffer with 10mM dNTP mix MgCl2 2.5mM, if needed DNA Polymerase

Add water to 25ul

1. 95°C, 5 minutes 2. 95°C, 40 seconds 3. 60°C, 40 seconds 4. 72°C, 40 seconds 5. Repeat steps 2 through 4 for 45 times. 6. 72°C, 4 minutes 7. 4°C

The PCR production is also can be conformed by sequencing: Only CG sequences are stay in CG without converted and no CC, CT or CA sequences can be detected. That means the C is converted to T except the methylated CG.

TTTTCGCGTTAGAGACGTAGTCGCGTTTTTATTATTTATATTTATCGCGTTTTCGTTCGTTTTTTTTTCG GGAGTTAGTTCGCGTTATCGTCGTTGTTTAGGTTATCGTTATTTTTCGTAGTTATGTTTATTAGGTTCG TGTTTTCGTTTTTTTATCGTAGGATGTTCGGCGGTTCGGGTATCGCGAGTCGGTCGAGTTTT

Store at -20°C. Stable for 6 months after receipt at -20°C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.

~250ng/ul

This product as supplied is intended for research use only, not for use in human, therapeutic or diagnostic applications without the expressed written authorization of United States Biological.